View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8970_low_30 (Length: 260)
Name: NF8970_low_30
Description: NF8970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8970_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 43518937 - 43519087
Alignment:
| Q |
1 |
atctattttaatcatgaaaaatctaattgatgccaaatcagaaggaaaaaacaaaccttttatagtgatacagaccttatatagttttttgctattttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
43518937 |
atctattttaatcatgaaaaatctaattgatgccaaatcagaaggaaaaaacaaaccttatatagt--------------------ttttgctattttga |
43519016 |
T |
 |
| Q |
101 |
atctatccataattggctaaaatgggtaaattaagaccatccatagatcatttgtcttttacgcaatattc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43519017 |
atctatccataattggctaaaatgggtaaattaagaccatccatagatcatttgtcttttacgcaatattc |
43519087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University