View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8970_low_33 (Length: 241)
Name: NF8970_low_33
Description: NF8970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8970_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 42717019 - 42716811
Alignment:
| Q |
15 |
agcacgatcaatcatgttagcgagactatcttcattggatcccgcaagcgaagcattgccaacggcggttacgttagtttccggtagaagaagttccgtc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42717019 |
agcacgatcaatcatgttagcgagactatcttcattggatcccgcaagcgaagcattgccaacggcggttacgttagtttccggtagaagaagttccgtc |
42716920 |
T |
|
| Q |
115 |
tccaccgtcgagttagcggcgaggagagagaaagagaatgaaggataacaaagaagtagatggcagagaatgaggactttgagaatcgcatgtgatgata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42716919 |
tccaccgtcgagttagcggcgaggagagagaaagagaatgaaggataacaaagaagtagatggcagagaatgaggactttgagaatcgcatgtgatgata |
42716820 |
T |
|
| Q |
215 |
acctcatct |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
42716819 |
acctcatct |
42716811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University