View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8970_low_36 (Length: 238)
Name: NF8970_low_36
Description: NF8970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8970_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 48476613 - 48476387
Alignment:
| Q |
1 |
taaatactaaaataaagagaaaaattactacattgaaaacttttt----gtgtgtgtattaccttaaaacattatgcaccctgaccctgggtcctggatc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48476613 |
taaatactaaaataaagagaaaaattactacattgaaaactttttttgtgtgtgtgtattaccttaaaacattatgcaccctgaccctgggtcctggatc |
48476514 |
T |
 |
| Q |
97 |
atgactgttggttgttgtatgttgcacctgaatataagctttttgaataaagttactgcaatcactttgctaatctaaaggtccaacaatggaattttca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48476513 |
atgactgttggttgttgtatgttgcacctgaatataagctttttgaataaagtaactgcaatcactttgctaatctaaaggtccaacaatggaattttca |
48476414 |
T |
 |
| Q |
197 |
aattgaacctttttctcttggttcatc |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48476413 |
aattgaacctttttctcttggttcatc |
48476387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University