View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_high_32 (Length: 377)
Name: NF8971_high_32
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 12 - 367
Target Start/End: Complemental strand, 7969643 - 7969286
Alignment:
| Q |
12 |
agagatgcgatggtttctaaatgatatgcattggtgatgataatgatgacaacgatgtttgatgnnnnnnntgtgtcttttggtctttcatatttttggc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7969643 |
agagatgcgatggtttctaaatgatatgcattggtgatgataatgatgacaacgatgtttgatgaaaaaaatgtgtcttttggtctttcatatttttggc |
7969544 |
T |
 |
| Q |
112 |
aattagtatatgttattgtccttttcctttatggttcggacagtgtagattacatgggaatttcggctcatttt-gtcaggtgccagcatttgctaagga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7969543 |
aattagtatatgttattgtccttttcctttatggttcggacagtgtagattacatgggaatttcggctcatttttgtcaggtgccagcatttgctaagga |
7969444 |
T |
 |
| Q |
211 |
aactacaaacttggttattaacgttctattttgctactttaaccttttt-ataaataggcttagttaaaatcacctttttattttactgtcttttgtcca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
7969443 |
aactacaaacttggttattaacgttctattttgctactttaaccttttttataaataggcttagataaattcacctttttattttactgtcttttgtcca |
7969344 |
T |
 |
| Q |
310 |
tacctcagtctaatattgtggtgcaactttgcattagtgtatatttttggttggtaat |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7969343 |
tacctcagtctaatattgtggtgcaactttgcattagtgtatatttttggttggtaat |
7969286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University