View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8971_high_57 (Length: 241)

Name: NF8971_high_57
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8971_high_57
NF8971_high_57
[»] chr8 (1 HSPs)
chr8 (9-134)||(14742634-14742757)


Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 9 - 134
Target Start/End: Original strand, 14742634 - 14742757
Alignment:
9 ttgtttccataaagatgacttaggattagagattgaaatctctgatgatataaagatgacatacatactctgaagaagggttattaatgtagtatgtagc 108  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
14742634 ttgtttccataaagatgacttaggattagagatttaaatctctgatgata--aagatgacatacatactctgaagaagggttattaatgtagtatgtagc 14742731  T
109 ggataaaatacttgcatgctagttgg 134  Q
    ||||||||||||| ||||||||||||    
14742732 ggataaaatactttcatgctagttgg 14742757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University