View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_123 (Length: 250)
Name: NF8971_low_123
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_123 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 39582141 - 39582374
Alignment:
| Q |
1 |
ttgtctgtttgtttctctttttatttttaaatatttgaaatttgatttaacaactactggaaccattagagacctgaaaaatgaaaaatctctgttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39582141 |
ttgtctgtttgtttctctttttatttttaaatatttgaaatttgatttaacaactactggaaccattagagacctgaaaaatgaaaaatccctgttaaaa |
39582240 |
T |
 |
| Q |
101 |
cgtgattggttggttcggattatagatgcacttaatataataatttattttctatggagactagctagagacatccttcctactagatagatgtagaccg |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39582241 |
cgtgattggttggtttggattatagatgcacttaatataataatttattttctatggagactagctagagatatccttcctactagatagatgtagaccg |
39582340 |
T |
 |
| Q |
201 |
aagcgaaaaggattgagtatagacaccatttgcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39582341 |
aagcgaaaaggattgagtatagacaccatttgcc |
39582374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 150
Target Start/End: Original strand, 39581544 - 39581600
Alignment:
| Q |
94 |
gttaaaacgtgattggttggttcggattatagatgcacttaatataataatttattt |
150 |
Q |
| |
|
|||||||| ||||||||||||| ||||| | || ||||||| ||||||||||||||| |
|
|
| T |
39581544 |
gttaaaacatgattggttggtttggattttcgacgcacttattataataatttattt |
39581600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 150
Target Start/End: Original strand, 39576961 - 39577042
Alignment:
| Q |
69 |
gagacctgaaaaatgaaaaatctctgttaaaacgtgattggttggttcggattatagatgcacttaatataataatttattt |
150 |
Q |
| |
|
||||| ||||||| |||| ||| ||||| |||||||||||| ||| ||||| ||||| || ||| ||||||||||||||| |
|
|
| T |
39576961 |
gagacatgaaaaaggaaagctctacgttaagacgtgattggttagttaggattttagatacatttattataataatttattt |
39577042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University