View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_126 (Length: 247)
Name: NF8971_low_126
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_126 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 3171049 - 3170948
Alignment:
| Q |
1 |
ctattaaaaaatttggaaataatttgaccgattttcatatatttaaaaagtgaatgatagtctaaaatcatgtctaattttgtatgtattgtcaagctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3171049 |
ctattaaaaaatttggaaataatttgaccgattttcatgtatttaaaaagtgaatgatagtctaaagtcatgtctaattttgtatgtattgtcaagctcg |
3170950 |
T |
|
| Q |
101 |
ag |
102 |
Q |
| |
|
|| |
|
|
| T |
3170949 |
ag |
3170948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 135 - 237
Target Start/End: Complemental strand, 3170915 - 3170812
Alignment:
| Q |
135 |
gagttgtcactcataaactagttgttt-ttagtttatttcttttggatttgactctcgttaattnnnnnnnttatgattaactcataataatttaatcga |
233 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3170915 |
gagttgtcactcataaactagttgttgcttagtttatttcttttggatttgactcttgttaattaaaaaaattatgattaactcataataatttaatcga |
3170816 |
T |
|
| Q |
234 |
gtat |
237 |
Q |
| |
|
|||| |
|
|
| T |
3170815 |
gtat |
3170812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University