View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_129 (Length: 241)
Name: NF8971_low_129
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_129 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 9 - 134
Target Start/End: Original strand, 14742634 - 14742757
Alignment:
| Q |
9 |
ttgtttccataaagatgacttaggattagagattgaaatctctgatgatataaagatgacatacatactctgaagaagggttattaatgtagtatgtagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14742634 |
ttgtttccataaagatgacttaggattagagatttaaatctctgatgata--aagatgacatacatactctgaagaagggttattaatgtagtatgtagc |
14742731 |
T |
 |
| Q |
109 |
ggataaaatacttgcatgctagttgg |
134 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
14742732 |
ggataaaatactttcatgctagttgg |
14742757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University