View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_134 (Length: 229)
Name: NF8971_low_134
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_134 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 1781240 - 1781373
Alignment:
| Q |
1 |
attctttcgccggatcgacatgatgcttttgctgctggtgagaaaacgccggatccgtctgttaggtcttatgctgatattatgagagatgaagcgttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1781240 |
attctttcgccggatcgacatgatgcttttgctgctggtgagaaaacgccggatccgtctgttaggtcttatgctgatattatgagagatgaagcgttga |
1781339 |
T |
 |
| Q |
101 |
agagggagagagaggaaacaattaggttaatttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1781340 |
agagggagagagaggaaacaattaggttaatttc |
1781373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 161 - 211
Target Start/End: Original strand, 1781400 - 1781450
Alignment:
| Q |
161 |
ctggtaaggctgcacctgtggctgagaaggaaaaatctcagcagaatcaac |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1781400 |
ctggtaaggctgcacccgtggctgagaaggaaaaatctcagcagaatcaac |
1781450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University