View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_136 (Length: 223)
Name: NF8971_low_136
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_136 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39582719 - 39582919
Alignment:
| Q |
1 |
tcctccaccttttggtatggtgaaactgaatgttgatgcagaagttatcaatgatggtcatataggatgtgggatggtaattggaggtatagtgaaggga |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39582719 |
tcctccaccctttggtatggtgaaactgaatgttgatgcagaagttatcaatgatggtcatataggatgtgggatggtaattggaggtatagtgaaggga |
39582818 |
T |
|
| Q |
101 |
atgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacggtggtgcctgcagtggattttggcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39582819 |
atgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacgatggtgcctgcagtggattttggcttc |
39582918 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
39582919 |
a |
39582919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 177
Target Start/End: Original strand, 53330817 - 53330898
Alignment:
| Q |
96 |
agggaatgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacggtgg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| || || | | | |||| |||||||| |||| ||| ||||| |||||| |
|
|
| T |
53330817 |
agggaatgtcaagtttgctgcaacaaagttagacaatatccgagtgtctcttactatggctgaaataatagcgctgcggtgg |
53330898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Complemental strand, 39581657 - 39581625
Alignment:
| Q |
190 |
attttggcttcattattatcagcttcttaattc |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
39581657 |
attttggctgcattattatcagcttcttaattc |
39581625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University