View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8971_low_137 (Length: 223)

Name: NF8971_low_137
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8971_low_137
NF8971_low_137
[»] chr4 (3 HSPs)
chr4 (1-201)||(39582719-39582919)
chr4 (96-177)||(53330817-53330898)
chr4 (190-222)||(39581625-39581657)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 39582719 - 39582919
Alignment:
1 tcctccaccttttggtatggtgaaactgaatgttgatgcagaagttatcaatgatggtcatataggatgtgggatggtaattggaggtatagtgaaggga 100  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39582719 tcctccaccctttggtatggtgaaactgaatgttgatgcagaagttatcaatgatggtcatataggatgtgggatggtaattggaggtatagtgaaggga 39582818  T
101 atgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacggtggtgcctgcagtggattttggcttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39582819 atgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacgatggtgcctgcagtggattttggcttc 39582918  T
201 a 201  Q
    |    
39582919 a 39582919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 177
Target Start/End: Original strand, 53330817 - 53330898
Alignment:
96 agggaatgtcaagtttgctgcaacaaagctagagaagattcaaatttctcctactatggttgaagcaatggcgctacggtgg 177  Q
    |||||||||||||||||||||||||||| |||| || || | | | |||| |||||||| ||||  ||| ||||| ||||||    
53330817 agggaatgtcaagtttgctgcaacaaagttagacaatatccgagtgtctcttactatggctgaaataatagcgctgcggtgg 53330898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 222
Target Start/End: Complemental strand, 39581657 - 39581625
Alignment:
190 attttggcttcattattatcagcttcttaattc 222  Q
    ||||||||| |||||||||||||||||||||||    
39581657 attttggctgcattattatcagcttcttaattc 39581625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University