View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_89 (Length: 337)
Name: NF8971_low_89
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 20032276 - 20031955
Alignment:
| Q |
1 |
tcttctttagctgaatcggtt----attctgcgtagaagttattttttgaatttattaatagctctgtttattcatgttcctcgaaaccctaacttcatt |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20032276 |
tcttctttagctgaatcggttggttattctgcgtagaagtgattttttgaatttatttatagctctgtttattcatgttcctcgaaaccctaacttcatt |
20032177 |
T |
|
| Q |
97 |
catttgatgtgtaaggaatggaacttgcttttagaattgttttaggtttcggatccaagttcttgttgttgttgaatgttaaggcttttcgtgtttcgaa |
196 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20032176 |
catgtgatgtgtaaggaatggaacttgcttttagaattgttttaggtttcggatccaagttcttgttgttgttgaatgttaaggcttttcgtgtttcgaa |
20032077 |
T |
|
| Q |
197 |
aatgcaactgtaagaaatttaggtttatttgttttccgttaatttaggtttaatcaatttcattttcataaattattacctgtgtcaacttgttagagtc |
296 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20032076 |
aatgcaactgtaagaaatttaagtttatttgttttccgttaatttaggtttaatcaatttcattttcataaattattacctgtgtcaacttgttagagtc |
20031977 |
T |
|
| Q |
297 |
gcgtcaagtgtttgtgtcggtg |
318 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
20031976 |
gcgtcaagtgtgtgtgtcggtg |
20031955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University