View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8971_low_90 (Length: 332)
Name: NF8971_low_90
Description: NF8971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8971_low_90 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 204 - 321
Target Start/End: Complemental strand, 24266811 - 24266694
Alignment:
| Q |
204 |
cagattaagttgggaactttggcttgtgggagtcattttactttggctgctgttgctcctttgctttttcttgttcctactgcgttacttatctatgtta |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266811 |
cagattaagttgggaactttggcttgtgggagtcattatactttggctgctgttgctcctttgctttttcttgttcctactgcgttacttatctatgtta |
24266712 |
T |
 |
| Q |
304 |
ttcttgtcctctctgctt |
321 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
24266711 |
ttcttgtcctctatgctt |
24266694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 24266997 - 24266899
Alignment:
| Q |
18 |
ataaaaaatgtcatcaatattagcaaaggtgttgatggagctgctgctagaaattacttggtgcagggttatgccgaacttgctgcggaagttaatact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266997 |
ataaaaaatgtcatcaatattagcaaaggtgttgatggagctgctgctagaaattacttggtgcagggttatgccgaacttgctgcggaagttaatact |
24266899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University