View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8972_high_12 (Length: 239)
Name: NF8972_high_12
Description: NF8972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8972_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 13462462 - 13462668
Alignment:
| Q |
16 |
ggcctaccaggcccacgcttgtaattaggagggagtatgcaaggtaactcagtttttggccacattttttgaccatttataggtgtaatggtctggtcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13462462 |
ggcctaccaggcccacgcttgtaattaggagggagtatgtaaggtaactcagtttttggccacattttttgaccatttataggtgtaatggtctgatcat |
13462561 |
T |
 |
| Q |
116 |
aacaatccaaataggnnnnnnngtgatagtatgtatgaacataactttgtggggattcaagtgccctaccaattgagacaacagcatgtctacatggtat |
215 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13462562 |
aacaatccaaatatgtttttttgtgatagtatgtatgaacataactttgtggggtttcaagtgccctaccaattgagaccacagcatgtctacatggtat |
13462661 |
T |
 |
| Q |
216 |
ccctact |
222 |
Q |
| |
|
||||||| |
|
|
| T |
13462662 |
ccctact |
13462668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University