View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8972_low_14 (Length: 390)

Name: NF8972_low_14
Description: NF8972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8972_low_14
NF8972_low_14
[»] chr5 (1 HSPs)
chr5 (33-136)||(32986591-32986695)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 33 - 136
Target Start/End: Original strand, 32986591 - 32986695
Alignment:
33 attgattataggaaaaatacctttggttggattggtgtcaactacctgaaaa-gtagaaagcaacatagcatcaatgagattggtagcagaatctaatca 131  Q
    |||||||| |||||||||||||||||||| |||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||    
32986591 attgattaaaggaaaaatacctttggttgtattggtgttaactacctgaaaaagtacaaagcaacatagcatcaatgagattggtagcagaatcaaatca 32986690  T
132 aacaa 136  Q
    |||||    
32986691 aacaa 32986695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University