View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8972_low_21 (Length: 312)
Name: NF8972_low_21
Description: NF8972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8972_low_21 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 17 - 312
Target Start/End: Complemental strand, 3171509 - 3171214
Alignment:
| Q |
17 |
aatgaggaattataaacgggaaatgaggttggcatagaaactcactgatgaagaagtaagggaggtgttggaagcaatattattaggcgcggataaggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3171509 |
aatgaggaattataaacgggaaatgaggttggcatagaaactcactgatgaagaagtaagggaggtgttggaagcaatattattaggcgcggataaggag |
3171410 |
T |
 |
| Q |
117 |
aaccggtacggaggagtagatacgctgctgactgccacggttgagttgagagggaaacagaaatatctgagggcggcagggcgcctttgatttcgttcgt |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3171409 |
aaccggtacagaggagtagatacgctgctgactgccacggttgagttgagagggaaacagaaatatctgagggcggcagggcgcctttgatttcgttcgt |
3171310 |
T |
 |
| Q |
217 |
gtttaggagatttgagtgatttacacgtcatacacgtatcaaagctcctacaaaaaattacatttagtcatcaaattatcggctcctcttatattt |
312 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3171309 |
gtttagaagatttgagtgatttacacgtcatacacgtatcaaagctcctgcaaaaaattacatttagtcatcaaattatcggctcctcttagattt |
3171214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University