View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8972_low_32 (Length: 228)
Name: NF8972_low_32
Description: NF8972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8972_low_32 |
 |  |
|
| [»] scaffold0012 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0012 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 162445 - 162235
Alignment:
| Q |
1 |
gtactgggtttcaacttcaagagcacaactaggaagcaatacatgcctgtgggtaatctacatccttcaacagtctcttacctataagacctctcgggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162445 |
gtactgggtttcaacttcaagagcacaactaggaagcaatacatgcctgtgggtaatttacatccttcaacagtctcttacctataagacctctcgggat |
162346 |
T |
 |
| Q |
101 |
tcatgtgctttggttcactcatgtatccgttgtcaataagcatgcaagtagtcgctcattgcacgtgctatgttgacggacgatcactccccaccctcgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
162345 |
tcatgtgctttggttcactcatgtatccgttgtcaataagcatgcaagtagtcgctcattgcacgtgctatgttgacggacgatcactccccaccctcgt |
162246 |
T |
 |
| Q |
201 |
cggccgcaaac |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
162245 |
cggccgcaaac |
162235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University