View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_high_23 (Length: 290)
Name: NF8973_high_23
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 23176773 - 23176511
Alignment:
| Q |
19 |
atcaagcactgaagcaagggcgtatggccgttgcaagagg-ttattatatcatgggagaacaacagaagtacattaagcaatgagcaaaacatgaggcgg |
117 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23176773 |
atcaagcacggaagcaagggcgtatggtcgttgcaagagggttgttatatcatgggagaacaacagaagtacattaagcaatgagcaaaacatgaggtgg |
23176674 |
T |
 |
| Q |
118 |
caccttaatccattgctcctagaaacactacaggaattttgtgtgcttcgaagccagaagcaaattagaatcatctacgaagctgttgcaacatttttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23176673 |
caccttaatccattgctcctagaaacactacaggaattttgtgtgcttcgaagccagaagcaaattagaatcatctacgaagctgttgcaacatttttcg |
23176574 |
T |
 |
| Q |
218 |
tgtgccaaatcaaaaccggggcaatttagtgtcagccaagcctatgctatgtagtgttgatgt |
280 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23176573 |
tgcgccaaatcaaaaccggggcaatttagtgtcagccaagcctatgctatgtagagttgatgt |
23176511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University