View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_high_25 (Length: 276)
Name: NF8973_high_25
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 36579450 - 36579694
Alignment:
| Q |
18 |
attcttaacacaggaatgagctctattgtccaggctactgccaacacataatgttgcatgcacatcatctctggcctctggcctgattttgcttcctact |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36579450 |
attcttaacacaggaatgagctttattgtccaggctactgccaacacataatgttgcatgcacatcatctctggcctctggcctgattttgcttcctact |
36579549 |
T |
 |
| Q |
118 |
ttgttcaccaattatggctgtaccaaaggtattttcaatatttgatatagatagatgaggcagatgaggttgaatttttcatttgtcgaaattaatatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36579550 |
ttgttcaccaattatggctgtaccaaaggtattttcaata-ttgatatagatagatgaggcagatgaggttgaatttttcatttgtcgaaattaatatgt |
36579648 |
T |
 |
| Q |
218 |
aaactccatcttagatggattaactgcattggctacaagaattatc |
263 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36579649 |
aaactccatcttagatggatttactgcattggctacaagaattatc |
36579694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University