View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_high_33 (Length: 213)
Name: NF8973_high_33
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_high_33 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 26 - 213
Target Start/End: Complemental strand, 29287703 - 29287516
Alignment:
| Q |
26 |
gcgcgtttgggagaaacaaacagaaacgcgcgcatctcaactgctgcaacagctgtggcatggcagaagtagtgtagcagatgcacctttgtgaagaaaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287703 |
gcgcgtttgggagaaacaaacagaaacacgcgcatctcaactgctgcaacagctgtggcatggcagaagtagtgtagcagatgcacctttgtgaagaaaa |
29287604 |
T |
 |
| Q |
126 |
cctgatatgtcgcgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttgagatgtgtgttagaaac |
213 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287603 |
cctgatatgtcgtgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttgagatgtgtgttagaaac |
29287516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35236433 - 35236228
Alignment:
| Q |
1 |
ggagaatttggaagagttggagcttgcgcgtttgggagaaacaaacagaaacgcgcgcatctcaactgctgcaacagctgtggcatggcagaagtagtgt |
100 |
Q |
| |
|
||||||||||||||||| ||| |||||| ||||||||||||||||||||||| |||||| |||| | || |||||| ||||||||| ||||| || || |
|
|
| T |
35236433 |
ggagaatttggaagagtcggaacttgcgtgtttgggagaaacaaacagaaacacgcgca-ctca---gttgaaacagccgtggcatgggagaagcagcgt |
35236338 |
T |
 |
| Q |
101 |
agcagatgcacctttgtgaagaaaacctgatatgtcgcgcggaaaatgcaacatagactcctatttttcctttaataaaaaccgaggtaggtgttgagat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
35236337 |
ggcagatgcacctttgtggagaaaacctgatatgtcgcgaggaaaatgcaacatagactcctatttttcttttaataaaaaccggggtaggttttgagat |
35236238 |
T |
 |
| Q |
201 |
gtgtgttaga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35236237 |
gtgtgttaga |
35236228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 29290865 - 29290835
Alignment:
| Q |
1 |
ggagaatttggaagagttggagcttgcgcgt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29290865 |
ggagaatttggaagagttggagcttgcgcgt |
29290835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University