View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_low_40 (Length: 326)
Name: NF8973_low_40
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 13 - 309
Target Start/End: Original strand, 6321388 - 6321684
Alignment:
| Q |
13 |
tttggtgttgaattgggtgttaggtggcaataggtatgcgacacattcatttgctatttataacttttcatcatacatgcatgtgttagtaatatgagtc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321388 |
tttgatgttgaattgggtgttaggtggcaataggtatgcgacacattcgtttgctatttataacttttcatcatacatgcatgtgttagtaatatgagtc |
6321487 |
T |
|
| Q |
113 |
aatggattgattccacaaagggttgaaagcaaaagaaactgaaaatcgtgaaaacattagttctcaatttaatcttggtggtgattgataatattttgaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
6321488 |
aatggattgattccacaaagggttgaaagcaaaagaaactgaaaatcgtgaaaacattagttctctatttaatcttggtggtgattgctaatattttgaa |
6321587 |
T |
|
| Q |
213 |
acattttaaataaattaccacaactttttattctttgaaaacatgaagaataatgctacttttgcagctccaaacttgaaggcagaccactatgttg |
309 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321588 |
acattttatataaattaccacaactttttattctttgaaaacatgaagaataatgctacttttgcagctccaaacttgaaggcagaccactatgttg |
6321684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University