View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_low_55 (Length: 266)
Name: NF8973_low_55
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 23 - 253
Target Start/End: Original strand, 44296657 - 44296884
Alignment:
| Q |
23 |
cacaagtccaaatagttctagagcagtcatccaactaacttaattattctgtttacgacttatcgaatagaatctttttactctcactaaattaagcatt |
122 |
Q |
| |
|
||||||||||| ||||||||||||| || ||| ||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44296657 |
cacaagtccaagtagttctagagcaatcgtcctactaacttaattattatgtttacgacttatagaatataatctttttactctcactaaattaagcatt |
44296756 |
T |
|
| Q |
123 |
tccctcccaaaattttattgactaattattgtgtttatcacctatacaacgatgtannnnnnnnatctaaatacatatttatagtatttgtttttgcttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44296757 |
tccctcccaaaattttattgactaattattgtgtttatcacctatacaacgatgta---tttttatctaaatacatattcatagtatttgtttttgcttt |
44296853 |
T |
|
| Q |
223 |
cattactaaaaatttctagatctatatatct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44296854 |
cattactaaaaatttctagatctatatatct |
44296884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University