View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_low_63 (Length: 243)
Name: NF8973_low_63
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 43571761 - 43571971
Alignment:
| Q |
14 |
ataatacttggaaatacttatcatttggctttgagacctacttctgagcttcttgaccaacttggtggtcttcacaaatttatgaattggccacgcgcca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43571761 |
ataatacttggaaatacttatcatttggctttgagacctacttctgagcttcttgaccaacttggtggtcttcacaaatttatgaattggccacgcgcca |
43571860 |
T |
 |
| Q |
114 |
tgcttaccgactctggtggctttcaaatggtttcacttttgcatcttgcggatatcacagaaaaaggtgtcacgtttcagtcacctgtagatggaaagcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43571861 |
tgcttaccgactctggtggctttcaaatggtttcacttttgcatcttgcggatatcacagaaaaaggtgtcacatttcagtcacctgtagatggaaagcc |
43571960 |
T |
 |
| Q |
214 |
gatgcttctaa |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
43571961 |
gatgcttctaa |
43571971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University