View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8973_low_70 (Length: 229)

Name: NF8973_low_70
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8973_low_70
NF8973_low_70
[»] chr1 (1 HSPs)
chr1 (1-214)||(29846875-29847070)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 29846875 - 29847070
Alignment:
1 cttaggagatatgtcttgatttctttttatttatacagaaagacacttaattgaatatttattttatcatatcttgttatacaatttttggcatacattt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||              ||||||||||||||||||||| ||||    
29846875 cttaggagatatgtcttgatttctttttatttatacagaaagacacttaattgaatattt--------------tgttatacaatttttggcatatattt 29846960  T
101 tatcatatcttgaaatttcttaaaatgatagcatgcaatgactattttacggccgtttttgtagagaatttgaacttaacttttatctcttgagattaca 200  Q
    |||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
29846961 tatcatatcttgaaatttcttaaaatgatagca----atgactattttacggccgtttttgtagagaatttgaacttaacttttatctcttgagatgaca 29847056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University