View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8973_low_70 (Length: 229)
Name: NF8973_low_70
Description: NF8973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8973_low_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 29846875 - 29847070
Alignment:
| Q |
1 |
cttaggagatatgtcttgatttctttttatttatacagaaagacacttaattgaatatttattttatcatatcttgttatacaatttttggcatacattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
29846875 |
cttaggagatatgtcttgatttctttttatttatacagaaagacacttaattgaatattt--------------tgttatacaatttttggcatatattt |
29846960 |
T |
 |
| Q |
101 |
tatcatatcttgaaatttcttaaaatgatagcatgcaatgactattttacggccgtttttgtagagaatttgaacttaacttttatctcttgagattaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29846961 |
tatcatatcttgaaatttcttaaaatgatagca----atgactattttacggccgtttttgtagagaatttgaacttaacttttatctcttgagatgaca |
29847056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University