View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8975_low_20 (Length: 335)
Name: NF8975_low_20
Description: NF8975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8975_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 74 - 319
Target Start/End: Original strand, 10990407 - 10990668
Alignment:
| Q |
74 |
tatagcttcaatttattaggtgacgtaaaggttagaaaaagatgaagggaaaggtcccatgaaatcagtaccccgacaaccaaaa--------------- |
158 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10990407 |
tatagcttcaatttattaggtgacataaaggttagaaaaagatgaagggaaaggtcccatgaaatcagtaccccgacaaccaaaagttccaatttccaaa |
10990506 |
T |
|
| Q |
159 |
-tttcgtgtaggggcatctcannnnnnnnagcaatactgcttgttgatcaattttatctccatttgtaatggcctccatacgaagtactatggcaatgtt |
257 |
Q |
| |
|
||||||||||| |||||||| |||||||| || ||||||||| ||||||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
10990507 |
atttcgtgtaggagcatctcattttttttagcaataccgcatgttgatcagttttatctccatttgtaatggcctccatatgaagaactatggaaatgtt |
10990606 |
T |
|
| Q |
258 |
acatgatgtccctttattcttttctgttcacacatcttatcgacccgttagggccttctttg |
319 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10990607 |
agatgatgtccctttattcttttctgttcacacatcttatcgacccgttagggccttctttg |
10990668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 10985300 - 10985360
Alignment:
| Q |
1 |
tattttgcaagaacactctccaatattgattacataaatgttttcgtttgtcacttatcaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10985300 |
tattttgcaagaacactctccaatattgattacataaatgttttcgtttgtcactgatcaa |
10985360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University