View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8975_low_32 (Length: 252)

Name: NF8975_low_32
Description: NF8975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8975_low_32
NF8975_low_32
[»] chr1 (1 HSPs)
chr1 (1-238)||(3265739-3265976)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 3265976 - 3265739
Alignment:
1 ggagaacactctcaggttccaagccaataattcttgtaatgatctaatcttcactaagaggattacctatgaggagcatctggtggatgtggtaaaattc 100  Q
    |||| |||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||     
3265976 ggagcacactcccaagttccaagtcaataattcttgtaatgatctaatcttcactaagaggattacatatgaggagcatctggtggatgtggtaaaattt 3265877  T
101 ttgctcttacgagtgggaggtggaacccgtcatgtgcaagggtagagttttggggtgttggcggagtcaggttgttgtgctttaggatgcttggtgggac 200  Q
    ||||||||||||||||| ||||||||||  ||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||    
3265876 ttgctcttacgagtggggggtggaacccaccatgtgcaaaggtagagttttggggtgttggcggagtcgggttgctgtgctttaggatgcttggtgggac 3265777  T
201 gctttcgattatcctcttaggaatagttatgtgatgtc 238  Q
    |||||||||| |||||||||||||||||||||||||||    
3265776 gctttcgattctcctcttaggaatagttatgtgatgtc 3265739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University