View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8975_low_36 (Length: 239)
Name: NF8975_low_36
Description: NF8975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8975_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 49521183 - 49521405
Alignment:
| Q |
1 |
cttcttctgatagcattgcatcagaagggtggattagaattctatcaagcacttcaattgggaataggaattgcttcccaacttgcttttcccacctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49521183 |
cttcttctgatagcattgcatcagaagggtggattagaattctatcaagcacttcaattgggaataggaattgcttcccaacttgcttttcccacctctg |
49521282 |
T |
 |
| Q |
101 |
ctcaaaattgtacaacacatcccatgcaataggtccttctagcttgcagtgaatatcatgccacggttctctaggaccacctttcttaatagaagcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49521283 |
ctcaaaattgtacaacacatcccatgcaataggtccttctagcttgcagtgaatatcatgccacggttctctaggaccacctttcttaatagaagcacct |
49521382 |
T |
 |
| Q |
201 |
gggaaatttggttgatgaaaatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
49521383 |
gggaaatttggttgatgaaaatc |
49521405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 69 - 201
Target Start/End: Original strand, 49510108 - 49510240
Alignment:
| Q |
69 |
aattgcttcccaacttgcttttcccacctctgctcaaaattgtacaacacatcccatgcaataggtccttctagcttgcagtgaatatcatgccacggtt |
168 |
Q |
| |
|
||||| || ||||||||||||||||| || |||||||||||| ||||||||||||| |||| |||||||||||| || || |||||||||||||| || | |
|
|
| T |
49510108 |
aattgttttccaacttgcttttcccatctttgctcaaaattgcacaacacatcccaagcaacaggtccttctagtttacaatgaatatcatgccatggct |
49510207 |
T |
 |
| Q |
169 |
ctctaggaccacctttcttaatagaagcacctg |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
49510208 |
ctctaggaccacctttattaatagaagcacctg |
49510240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 44662438 - 44662311
Alignment:
| Q |
96 |
ctctgctcaaaattgtacaacacatcccatgcaataggtccttctagcttgcagtgaatatcatgccacggttctctaggaccacctttcttaatagaag |
195 |
Q |
| |
|
||||||||||| || |||| |||||||| ||||| || ||||| ||| | |||| ||||||||||| ||||| |||||||||||||| | || |||| |
|
|
| T |
44662438 |
ctctgctcaaagttaaacaaaacatcccaagcaatgggaccttcaagccttgagtggatatcatgccaaggttccctaggaccacctttttctattgaag |
44662339 |
T |
 |
| Q |
196 |
cacctgggaaatttggttgatgaaaatc |
223 |
Q |
| |
|
|||| || || || || ||||||||||| |
|
|
| T |
44662338 |
caccaggaaagttaggctgatgaaaatc |
44662311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University