View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8975_low_44 (Length: 202)
Name: NF8975_low_44
Description: NF8975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8975_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 43145489 - 43145665
Alignment:
| Q |
17 |
attaggtactacttaaaacatggaaaagttatcaaggtaagttggtcgtggctttatgtcgttatctctgactta-tttctttata--gttgttttctca |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
43145489 |
attaggtactacttaaaacatggaaaagttatcaaggtaagttggtcatggctttatgtcgttatctctgacttaatttctttatatagttgttttctca |
43145588 |
T |
 |
| Q |
114 |
accaaaaagtatttgaatgtatactttgcagatagaaagaactgaaagaagcaaagatatgagtccaattttcacag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43145589 |
accaaaaagtatttgaatgtatactttgcagatagaaagaactgaaagaagcaaagatatgagtccaattttcacag |
43145665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 21 - 190
Target Start/End: Original strand, 43158724 - 43158897
Alignment:
| Q |
21 |
ggtactacttaaaacatggaaaagttatcaaggtaagttggtcgtggctttatgtcgttatctctgactt-atttctttata---gttgttttctcaacc |
116 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||| ||||| ||||||||||||| |||| |||||| |||||||| || ||| ||||||||||| |
|
|
| T |
43158724 |
ggtactatttaaaacatggaaaaattatcaaggtaagctggtcaaggctttatgtcgtcatctgtgacttgatttctttttaaaagttattttctcaacc |
43158823 |
T |
 |
| Q |
117 |
aaaaagtatttgaatgtatactttgcagatagaaagaactgaaagaagcaaagatatgagtccaattttcacag |
190 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43158824 |
aaaaagtatttgaatatatactctgcagattgaaagaactgaaagaagcaaagatatgagtccagttttcacag |
43158897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University