View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8976_high_14 (Length: 237)
Name: NF8976_high_14
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8976_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 22 - 218
Target Start/End: Complemental strand, 33497876 - 33497681
Alignment:
| Q |
22 |
actaatcatagtaaacgatccatgtttgacactgtatacgggccagatccccatctatggtaacaagaaggatcgaattttaagaaccctagtagatcta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33497876 |
actaatcatagtaaacgatccatgtttgacattgtatacgggccagatccctatctatggtaacaagaaggatcgaattttaagaaccctagtagatcta |
33497777 |
T |
 |
| Q |
122 |
ttgcccatttaagaaccctagctagatgggggattttaaggatcgtgatcaagaataaaagatacatcttttgatcgttaccctagcttatatgagt |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33497776 |
ttgcccctttaagaaccctagctagatgggggattttaaggatcgtgatcaagaataaaagatacatcttttg-tcgttaccctagcttatatgagt |
33497681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 33485102 - 33485011
Alignment:
| Q |
22 |
actaatcatagtaaacgatccatgtttgacactgtatacgggccagatccccatctatggtaacaagaaggatcgaattttaagaaccctag |
113 |
Q |
| |
|
||||||||| ||||| |||||| |||||||| ||||| |||||| | |||| | ||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
33485102 |
actaatcattgtaaatgatccaagtttgacattgtattcgggcctggtccctaactacggtaacaagaaggatccaagtttaagaaccctag |
33485011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University