View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8976_low_23 (Length: 267)

Name: NF8976_low_23
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8976_low_23
NF8976_low_23
[»] chr2 (2 HSPs)
chr2 (171-267)||(2484664-2484760)
chr2 (18-66)||(2484510-2484558)
[»] chr7 (3 HSPs)
chr7 (212-259)||(11828265-11828312)
chr7 (31-64)||(8574429-8574462)
chr7 (18-64)||(11828384-11828430)


Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 171 - 267
Target Start/End: Original strand, 2484664 - 2484760
Alignment:
171 ataaggttgcttgttaatgccggttattttgttcggtttaatttgacttggttcttttatttggatggtttctctctttggttgtttgaaataactt 267  Q
    |||||||||||| | |||||||||||||||||| |||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2484664 ataaggttgcttctcaatgccggttattttgtttggtttggtttgacttggttcttttatttggatggtttctctctttggttgtttgaaataactt 2484760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 2484510 - 2484558
Alignment:
18 gcttctccctgttttgattcttctaattgattgcttctctcccttttta 66  Q
    ||||||||||||||||||||||||||||||||| ||||| |||||||||    
2484510 gcttctccctgttttgattcttctaattgattgtttctcccccttttta 2484558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 11828312 - 11828265
Alignment:
212 tttgacttggttcttttatttggatggtttctctctttggttgtttga 259  Q
    ||||||||||||||| || |||||||||||||||||||||||| ||||    
11828312 tttgacttggttcttctacttggatggtttctctctttggttgattga 11828265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
31 ttgattcttctaattgattgcttctctccctttt 64  Q
    ||||||||||||||||||||||||||||||||||    
8574429 ttgattcttctaattgattgcttctctccctttt 8574462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 11828430 - 11828384
Alignment:
18 gcttctccctgttttgattcttctaattgattgcttctctccctttt 64  Q
    |||||||||  ||||||||||| ||||||||||||||| ||||||||    
11828430 gcttctcccccttttgattcttttaattgattgcttctttccctttt 11828384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University