View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8976_low_24 (Length: 267)
Name: NF8976_low_24
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8976_low_24 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 171 - 267
Target Start/End: Original strand, 2484664 - 2484760
Alignment:
| Q |
171 |
ataaggttgcttgttaatgccggttattttgttcggtttaatttgacttggttcttttatttggatggtttctctctttggttgtttgaaataactt |
267 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484664 |
ataaggttgcttctcaatgccggttattttgtttggtttggtttgacttggttcttttatttggatggtttctctctttggttgtttgaaataactt |
2484760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 2484510 - 2484558
Alignment:
| Q |
18 |
gcttctccctgttttgattcttctaattgattgcttctctcccttttta |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2484510 |
gcttctccctgttttgattcttctaattgattgtttctcccccttttta |
2484558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 212 - 259
Target Start/End: Complemental strand, 11828312 - 11828265
Alignment:
| Q |
212 |
tttgacttggttcttttatttggatggtttctctctttggttgtttga |
259 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
11828312 |
tttgacttggttcttctacttggatggtttctctctttggttgattga |
11828265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 64
Target Start/End: Original strand, 8574429 - 8574462
Alignment:
| Q |
31 |
ttgattcttctaattgattgcttctctccctttt |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8574429 |
ttgattcttctaattgattgcttctctccctttt |
8574462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 11828430 - 11828384
Alignment:
| Q |
18 |
gcttctccctgttttgattcttctaattgattgcttctctccctttt |
64 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11828430 |
gcttctcccccttttgattcttttaattgattgcttctttccctttt |
11828384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University