View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8976_low_28 (Length: 239)
Name: NF8976_low_28
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8976_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 23 - 141
Target Start/End: Original strand, 38482280 - 38482405
Alignment:
| Q |
23 |
cgtaggtagaaaaactctgaaccaaacatgctataagtatgtttaatttcaattaagagatatgcataca-------tttaatgtataacacaaattgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38482280 |
cgtaggtagaaaaactctgaaccaaacaggttataagtatgtttaatttcaatgaagagatatgcatacatttaatgtttaatgtataacacaaattgaa |
38482379 |
T |
 |
| Q |
116 |
tagataattacttttgatggtttgat |
141 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
38482380 |
tagagaattacttttgatggtttgat |
38482405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University