View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8976_low_32 (Length: 237)
Name: NF8976_low_32
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8976_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 9881025 - 9880831
Alignment:
| Q |
1 |
cttacacgatagcttaactctccaaaagggtgattttcccctaaccacccgtgatctttacaagaaattgtcctctctatggccaattttgaaaaatttg |
100 |
Q |
| |
|
|||||||| ||| |||||||| |||||||| |||| |||||||||||| | ||||| ||||||||| |||||||||||||||||| ||||||||||| | |
|
|
| T |
9881025 |
cttacacgctaggttaactcttcaaaagggggattctcccctaaccacatgcgatctctacaagaaaatgtcctctctatggccaaatttgaaaaattcg |
9880926 |
T |
 |
| Q |
101 |
aaaattgtgccccttggcaaaggcttctttgaacatcaatttaacaccgttgaagagatgcggaaaatatggtctttaaggttgttgagtctcaa |
195 |
Q |
| |
|
|| |||||||||||| ||||||| ||||||| || || ||| ||||| ||| ||||||||| ||| ||||||||||||||||||||| |||||| |
|
|
| T |
9880925 |
aatattgtgcccctttgcaaaggattctttgcacttctattcaacacagttaaagagatgcaaaaattatggtctttaaggttgttgaatctcaa |
9880831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 237
Target Start/End: Complemental strand, 9880760 - 9880716
Alignment:
| Q |
193 |
caagtttggattcgaattatgaacctcccgcaagagtattagaga |
237 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| ||| |||| |
|
|
| T |
9880760 |
caagtttggattcaaattatgaacctcccccaagagcattggaga |
9880716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 23262642 - 23262730
Alignment:
| Q |
1 |
cttacacgatagcttaactctccaaaagggtgattttcccctaaccacccgtgatctttacaagaaattgtcctctctatggccaattt |
89 |
Q |
| |
|
|||||||||||| |||||||| |||||||| |||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23262642 |
cttacacgataggttaactcttcaaaagggagattctcccctaaccacacgtgatctttacatgaaattgtcctctctatggccaattt |
23262730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 23262725 - 23262783
Alignment:
| Q |
137 |
caatttaacaccgttgaagagatgcggaaaatatggtctttaaggttgttgagtctcaa |
195 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
23262725 |
caatttaacacagttgaagagatgcgaaaaatatggtctttaaggtagttgagtctcaa |
23262783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 193 - 237
Target Start/End: Original strand, 23262854 - 23262898
Alignment:
| Q |
193 |
caagtttggattcgaattatgaacctcccgcaagagtattagaga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23262854 |
caagtttggattcgaattatgaacctcccgcaagagtattagaga |
23262898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University