View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8976_low_33 (Length: 231)
Name: NF8976_low_33
Description: NF8976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8976_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 37184810 - 37184616
Alignment:
| Q |
20 |
ggtagaaattattttaaggaaaatttcttcaatattgtaatacaaaccatatatgttaacattcaatactgttggttgtttacaaagagaatgtacaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37184810 |
ggtagaaattattttaaggaaaatttcttcaatattgtaatacaaaccatatatgttaacattcaatactgttggttgtttacaaagagaatgtacaatg |
37184711 |
T |
 |
| Q |
120 |
acatgtttcttgtgtttcaacttgttgccttgtgcatctgttcagtcacagtcttggaaatgccctgtctctgctagaagtagaaagcaaataacaccaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37184710 |
acatgtttcttgtgtttcaacttgttgccttgtgcatatgttcagtcacagtcttgg------gctgtctctgctagaagtagaaagcaaataacaccaa |
37184617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 135 - 199
Target Start/End: Complemental strand, 37212947 - 37212883
Alignment:
| Q |
135 |
ttcaacttgttgccttgtgcatctgttcagtcacagtcttggaaatgccctgtctctgctagaag |
199 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||| || | |||||||||||| ||||||| |
|
|
| T |
37212947 |
ttcaacttgttgccttgtggatatgttcagtcagagtctagggattgccctgtctctactagaag |
37212883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University