View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8977_low_15 (Length: 202)
Name: NF8977_low_15
Description: NF8977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8977_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 37348072 - 37348144
Alignment:
| Q |
10 |
gaagcagagacagtcacccataaatccttccaagttaaacaaattcccttctcttctccttcattcatctttt |
82 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
37348072 |
gaagcagaaacagtcacccataaatccttccaagttaaacaaactcccttctcttctcctccattcatctttt |
37348144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 141 - 175
Target Start/End: Original strand, 37348185 - 37348219
Alignment:
| Q |
141 |
agccatattgtgaacatataaatttgtctaaagtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37348185 |
agccatattgtgaacatataaatttgtctaaagtc |
37348219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University