View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8977_low_7 (Length: 393)
Name: NF8977_low_7
Description: NF8977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8977_low_7 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 361; Significance: 0; HSPs: 14)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 23286402 - 23286026
Alignment:
| Q |
1 |
gcgtacaatacaccaaatggtggggccctgcatatgcgggagctctagtgcaccgggctgccctttagttgtacatgtttttgatgattaatcatgcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23286402 |
gcgtacaatacaccaaatggtgggaccctgcatatgcgggagctctagtgcaccgggctgccctttagttgtacatgtttttgatgattaatcatgcttt |
23286303 |
T |
 |
| Q |
101 |
gcatctttcagattacattagtgttgatgtccctagaagcatgaaaaagcggctggtgcggatcacagttggcctgattactgttggatttttaacatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23286302 |
gcatctttcagattacattagtgttgatgtccctagaagcatgaaaaagcggctggtgcggatcacagttggcctgattactgttggatttttaacatgt |
23286203 |
T |
 |
| Q |
201 |
gcctgcataataatatttataaggaaaggtgagttttgaattagatttagtaacaattaaaatagtatgcaagcatccatatttaaatttacattctaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23286202 |
gcctgcataataatatttataaggaaaggtgagttttgaattagatttagtaacaattaaaatagtatgcaagcatccatatttaaatttacattctaaa |
23286103 |
T |
 |
| Q |
301 |
gcctaaacttgtttgttgtagtaactaaattcttgatgttgtcctgttgcacatttcagtggcaccaaggttatatc |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23286102 |
gcctaaacttgtttgttgtagtaactaaatacttgatgttgttatgttgcacatttcagtggcaccaaggttatatc |
23286026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 89 - 377
Target Start/End: Original strand, 23392236 - 23392542
Alignment:
| Q |
89 |
taatcatgctttgcatctttcagattacattagtgttgatgtccctagaagcatgaaaaagcggctggtgcggatcacagttggcctgattactgttgga |
188 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| || ||| |||||| |||||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
23392236 |
taatcatgctttgtttctttcagattactttagtgttgaagttcctggaagcacaaaaaagcggctgatgcggatcacagttggcctaattactattgga |
23392335 |
T |
 |
| Q |
189 |
tttttaacatgtgcctgcataataatatttataaggaaaggtgagttttgaattagatttagtaacaattaaaatag--tatgcaagcatccatatttaa |
286 |
Q |
| |
|
||||| ||||||||||| ||||||||| ||||| ||| |||| | ||||||||| ||| ||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23392336 |
tttttcacatgtgcctgaataataata-ttatagggagaggtaaattttgaattcgatacagtaacaattaaaatagtatatgcaagcatctatatttaa |
23392434 |
T |
 |
| Q |
287 |
-----------------atttacattctaaagcctaaacttgtttgttgtagtaactaaattcttgatgttgtcctgttgcacatttcagtggcaccaag |
369 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23392435 |
gttttttgaaaattctggtttacattcaaaagcctaaacttgtttgttgtagtaatgaatttcttgatgttgtcatgttgcacatttcagtggcaccaag |
23392534 |
T |
 |
| Q |
370 |
gttatatc |
377 |
Q |
| |
|
|||||||| |
|
|
| T |
23392535 |
gttatatc |
23392542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 30454137 - 30454097
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30454137 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30454097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 12670290 - 12670250
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
12670290 |
ccctgcatatgcgggagctctagtgcaccgggttacccttt |
12670250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 26102612 - 26102652
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
26102612 |
ccctgcttatgcgggagctctagtgcaccgggttgcccttt |
26102652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 17823671 - 17823712
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
17823671 |
ccctgcatatgcaggagctttagtgcaccgggttgcccttta |
17823712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 27037650 - 27037683
Alignment:
| Q |
33 |
tatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
27037650 |
tatgcgggagttctagtgcaccgggctgcccttt |
27037683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 6760923 - 6760959
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
6760923 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
6760959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 12625985 - 12626025
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
12625985 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
12626025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 20870024 - 20870060
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20870024 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
20870060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 27468132 - 27468092
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
27468132 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
27468092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 31457267 - 31457307
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
31457267 |
ccctgcgtatgcgggagctctagtgcaccggattgcccttt |
31457307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 35261774 - 35261814
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
35261774 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35261814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 39461034 - 39460994
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
39461034 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
39460994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 2e-19; HSPs: 24)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 4495741 - 4495676
Alignment:
| Q |
1 |
gcgtacaatacaccaaatggtggggccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
4495741 |
gcgtacaatacaccaaatggtgggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4495676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 5 - 66
Target Start/End: Complemental strand, 43956533 - 43956472
Alignment:
| Q |
5 |
acaatacaccaaatggtggggccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||| ||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
43956533 |
acaatacaccaaatggtgggacccagcgtatgcgggagctttagtgcaccgggctgcccttt |
43956472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 66
Target Start/End: Complemental strand, 54032633 - 54032571
Alignment:
| Q |
4 |
tacaatacaccaaatggtggggccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||| ||||||||| |||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
54032633 |
tacaatacaccgaatggtgggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
54032571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 31831280 - 31831344
Alignment:
| Q |
4 |
tacaatacaccaaatggtgggg-ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
31831280 |
tacaatacaccaaatggtccggaccctgcatatgcgggtgctctagtgcaccgggttgcccttta |
31831344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 34771404 - 34771364
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771404 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
34771364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 1217205 - 1217245
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1217205 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1217245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 30452912 - 30452952
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30452912 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30452952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 31592964 - 31593004
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31592964 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 6242325 - 6242285
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
6242325 |
ccctgcatatgcaggagctctagtgcaccgggttgcccttt |
6242285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 15797337 - 15797377
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
15797337 |
ccctgcatatgtgggagctctagtgcaccgggttgcccttt |
15797377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 22122957 - 22122918
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
22122957 |
ccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 27 - 66
Target Start/End: Complemental strand, 24851340 - 24851301
Alignment:
| Q |
27 |
cctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
24851340 |
cctgcatatgcgggagctttagtgcaccgggttgcccttt |
24851301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 29 - 67
Target Start/End: Original strand, 39203634 - 39203672
Alignment:
| Q |
29 |
tgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
39203634 |
tgcatatgcgggagctttagtgcaccgggttgcccttta |
39203672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 516529 - 516569
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
516529 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
516569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 10484656 - 10484616
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
10484656 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10484616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 13628830 - 13628790
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
13628830 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
13628790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 13730638 - 13730602
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
13730638 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
13730602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 24577952 - 24577992
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24577952 |
ccctgcatatacgggagctctagtgcaccggattgcccttt |
24577992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 24578042 - 24578082
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
24578042 |
ccctacatatgcgggaactctagtgcaccgggttgcccttt |
24578082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 26292447 - 26292487
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
26292447 |
ccctgcatatgcgggaactctagtgcaccgggttgtccttt |
26292487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 40272852 - 40272812
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
40272852 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40272812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 40390358 - 40390398
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
40390358 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40390398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 47624216 - 47624256
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
47624216 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
47624256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 54484808 - 54484848
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
54484808 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
54484848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 14)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 48735162 - 48735121
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48735162 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttta |
48735121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 21172049 - 21172009
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21172049 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
21172009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 32758354 - 32758394
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32758354 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
32758394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 42391140 - 42391100
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42391140 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
42391100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 10693113 - 10693072
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
10693113 |
ccctgcatatgcgggagctctagtgcactgggttgcccttta |
10693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 29 - 66
Target Start/End: Complemental strand, 31591146 - 31591109
Alignment:
| Q |
29 |
tgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31591146 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
31591109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 26 - 65
Target Start/End: Original strand, 18747582 - 18747621
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
18747582 |
ccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 11741890 - 11741927
Alignment:
| Q |
28 |
ctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
11741890 |
ctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 21566531 - 21566564
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggct |
59 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
21566531 |
ccctgcatatgcgggagctttagtgcaccgggct |
21566564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 28 - 65
Target Start/End: Original strand, 42476968 - 42477005
Alignment:
| Q |
28 |
ctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
42476968 |
ctgcatatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 32233175 - 32233135
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
32233175 |
ccctgcatatgagggagcttcagtgcaccgggctgcccttt |
32233135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 36602542 - 36602582
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
36602542 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
36602582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 42798764 - 42798804
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
42798764 |
ccctgcatatgcgggagctatagtgcatcgggttgcccttt |
42798804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 42805625 - 42805661
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
42805625 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
42805661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 30672 - 30712
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30672 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
30712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 48674 - 48634
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48674 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000009; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 1347057 - 1347097
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1347057 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1347097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 1354797 - 1354757
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1354797 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
1354757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 25557818 - 25557858
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25557818 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
25557858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 26097253 - 26097293
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26097253 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
26097293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 31 - 66
Target Start/End: Original strand, 25997749 - 25997784
Alignment:
| Q |
31 |
catatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25997749 |
catatgcgggagctctagtgcaccgggttgcccttt |
25997784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 10734945 - 10734904
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
10734945 |
ccctgcgtatgcgggagctttagtccaccgggctgcccttta |
10734904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 12892108 - 12892144
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
12892108 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
12892144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 29355895 - 29355855
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
29355895 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
29355855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000009; HSPs: 14)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 16028664 - 16028624
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16028664 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
16028624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 32703517 - 32703557
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32703517 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
32703557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 30877604 - 30877563
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
30877604 |
ccctgcatatgtgggagctctagtgcaccgggttgcccttta |
30877563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 34154854 - 34154813
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
34154854 |
ccctgcatatgcggtagctctagtgcaccgggttgcccttta |
34154813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 29 - 66
Target Start/End: Original strand, 35710409 - 35710446
Alignment:
| Q |
29 |
tgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35710409 |
tgcatatgcgggagctctagtgcaccgggttgcccttt |
35710446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 11462922 - 11462958
Alignment:
| Q |
28 |
ctgcatatgcgggagctctagtgcaccgggctgccct |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11462922 |
ctgcatatgcgggagctctagtgcaccgggttgccct |
11462958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 26 - 65
Target Start/End: Original strand, 19438761 - 19438800
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
19438761 |
ccctgcatatgcgggagctctagtgcaccaggttgccctt |
19438800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 63
Target Start/End: Original strand, 7368491 - 7368528
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccc |
63 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7368491 |
ccctgcatatgtgggagctctagtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 55
Target Start/End: Complemental strand, 22861709 - 22861680
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22861709 |
ccctgcatatgcgggagctctagtgcaccg |
22861680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 1405282 - 1405322
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
1405282 |
ccctgcatatgcgggagctctagtacaccggattgcccttt |
1405322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 34 - 66
Target Start/End: Complemental strand, 10943877 - 10943845
Alignment:
| Q |
34 |
atgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10943877 |
atgcgggagctttagtgcaccgggctgcccttt |
10943845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 16957409 - 16957449
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
16957409 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
16957449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 38879678 - 38879718
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
38879678 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38879718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Original strand, 41014417 - 41014453
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
41014417 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
41014453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000009; HSPs: 27)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 11054188 - 11054148
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11054188 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
11054148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 20225077 - 20225117
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20225077 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 38786704 - 38786744
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38786704 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
38786744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 54175160 - 54175200
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54175160 |
ccctgcatatgcgggagctttagtgcaccgggctgcccttt |
54175200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 27 - 62
Target Start/End: Original strand, 28494247 - 28494282
Alignment:
| Q |
27 |
cctgcatatgcgggagctctagtgcaccgggctgcc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
28494247 |
cctgcatatgcgggagctctagtgcaccgggctgcc |
28494282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 29207938 - 29207900
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccct |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29207938 |
ccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 23501884 - 23501924
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23501884 |
ccctgcatatgcgggagctttagtgcaccgggttgcccttt |
23501924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 32484328 - 32484368
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
32484328 |
ccctgcatatgcgggagctttagtgcaccgggttgcccttt |
32484368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 39077836 - 39077800
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39077836 |
ccctgcatatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 26 - 65
Target Start/End: Complemental strand, 8473660 - 8473621
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccctt |
65 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
8473660 |
ccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 11394947 - 11394988
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
11394947 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
11394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 11404674 - 11404715
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
11404674 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
11404715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Original strand, 19028013 - 19028046
Alignment:
| Q |
33 |
tatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
19028013 |
tatgcgggagctttagtgcaccgggctgcccttt |
19028046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 20225175 - 20225212
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
20225175 |
gcatatgcgggagctttagtgcaccgggttgcccttta |
20225212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 30690216 - 30690175
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
30690216 |
ccctgcgtatgcgggagctttagtgcaccaggctgcccttta |
30690175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 38755948 - 38755907
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
38755948 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
38755907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 40553977 - 40553936
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
40553977 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
40553936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 44363170 - 44363129
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
44363170 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
44363129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 66
Target Start/End: Complemental strand, 48598862 - 48598825
Alignment:
| Q |
29 |
tgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
48598862 |
tgcatatgccggagctctagtgcaccgggttgcccttt |
48598825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 9832353 - 9832313
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
9832353 |
ccctgcatatgcaggaactctagtgcaccgggttgcccttt |
9832313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 16408637 - 16408601
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
16408637 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
16408601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 20639698 - 20639658
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
20639698 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
20639658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 25629144 - 25629184
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
25629144 |
ccctacatatgcgggagctttagtgcaccgggttgcccttt |
25629184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 30639474 - 30639514
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| |||||||| |
|
|
| T |
30639474 |
ccctgcatatgcgggagctttagtgcactgggttgcccttt |
30639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 35532087 - 35532127
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
35532087 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
35532127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 35567265 - 35567305
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
35567265 |
ccctgcgtctgcgggagctttagtgcaccgggctgcccttt |
35567305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 47528570 - 47528530
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
47528570 |
ccctgaatatgtgggagctctagtgcaccgggttgcccttt |
47528530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000009; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 21779301 - 21779261
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21779301 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
21779261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 23397859 - 23397900
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23397859 |
ccctacatatgcgggagctctagtgcaccgggttgcccttta |
23397900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 14530415 - 14530456
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
14530415 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
14530456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 40416911 - 40416870
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
40416911 |
ccctgcatatgcgagagctttagtgcaccgggttgcccttta |
40416870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 9671274 - 9671314
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
9671274 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
9671314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 10543795 - 10543835
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
10543795 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 10546258 - 10546298
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
10546258 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10546298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 22371207 - 22371247
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
22371207 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
22371247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 34080196 - 34080236
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
34080196 |
ccctgcatatgcgggagttttagtgcaccgggttgcccttt |
34080236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 62
Target Start/End: Complemental strand, 39189540 - 39189508
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
39189540 |
gcatatgcgggagctctagtgcaccgggttgcc |
39189508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 44643618 - 44643658
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44643618 |
ccctgcgtatgcgggagccttagtgcaccgggctgcccttt |
44643658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 19414555 - 19414595
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19414555 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
19414595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 34725138 - 34725098
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34725138 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
34725098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 38478322 - 38478282
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38478322 |
ccctgcatatgcgggagctctagtgcaccgggttgcccttt |
38478282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 10378775 - 10378738
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgccc |
63 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10378775 |
ccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 23796583 - 23796623
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
23796583 |
ccctgcatatgctggagctttagtgcaccgggctgcccttt |
23796623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 35253227 - 35253187
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35253227 |
ccctgcatatgcgggagctctagtgcaccggattgcccttt |
35253187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 45812577 - 45812541
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45812577 |
ccctgcatatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 50606521 - 50606561
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
50606521 |
ccctgcatatgcgggagctttagtgcaccgggttgcccttt |
50606561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 4349756 - 4349797
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4349756 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttta |
4349797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 10668345 - 10668385
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
10668345 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10668385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 14617156 - 14617196
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||||| |
|
|
| T |
14617156 |
ccctgcatatgcgggagctttagtgcaccgggttacccttt |
14617196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 16120834 - 16120874
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
16120834 |
ccctgcatatgcgggagctttaatgcaccaggctgcccttt |
16120874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 20004126 - 20004090
Alignment:
| Q |
30 |
gcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20004126 |
gcatatgcgggagctttagtgcaccgggttgcccttt |
20004090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 20999890 - 20999850
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
20999890 |
ccctgcgtacgcgggagctttagtgcaccgggctgcccttt |
20999850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 54
Target Start/End: Original strand, 47214627 - 47214655
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcacc |
54 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47214627 |
ccctgcatatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 50760280 - 50760240
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
50760280 |
ccctgcgtatgcgggagctttaatgcaccgggctgcccttt |
50760240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 11224 - 11265
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttta |
67 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
11224 |
ccctgcatatgcgggagctctagtgcaccaggttgcccttta |
11265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Complemental strand, 24173 - 24133
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24173 |
ccctgcatatgcgggagctctagtgcaccggattgcccttt |
24133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 43753 - 43793
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||| | | |||||||| |
|
|
| T |
43753 |
ccctgcatatgcgggagctctagtgcactgagttgcccttt |
43793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 46926 - 46966
Alignment:
| Q |
26 |
ccctgcatatgcgggagctctagtgcaccgggctgcccttt |
66 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| |||||||| |
|
|
| T |
46926 |
ccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
46966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University