View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_high_27 (Length: 227)
Name: NF8978_high_27
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 8411843 - 8411919
Alignment:
| Q |
141 |
aactgtgaatggtaaacgggtcgcctatcgctgtgaaagtgcaaattatcactaataattcataagcattatcaaca |
217 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411843 |
aactgtgaatggaaaacgggtcgcctatcgctgtgaaagtgcaaattatcactaataattcataagcattatcaaca |
8411919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 43 - 105
Target Start/End: Original strand, 8411745 - 8411807
Alignment:
| Q |
43 |
ataagagtcataagaatcataaggtctttcttgaattggaagcacttgaatacatatctgtac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8411745 |
ataagagtcataagaatcataaggtctttcttgaattggaagcacttgaatacatatcggtac |
8411807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 8411657 - 8411701
Alignment:
| Q |
1 |
tcaaacagtttatgagcttatatgtggttgaaggtctttcttata |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411657 |
tcaaacagtttatgagcttatatgtggttgaaggtctttcttata |
8411701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University