View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_24 (Length: 443)
Name: NF8978_low_24
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 397; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 14 - 422
Target Start/End: Complemental strand, 34609450 - 34609042
Alignment:
| Q |
14 |
agaacaaaattaccaattatttcatcagcggtggtgagcttttcccttggggcgctttccagcaagagtgtgcttcggtctgagattaactataacccta |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609450 |
agaacaacattaccaattatttcatcagcggtggtgagcttttcccttggggcgctttccagcaagagtgtgcttcggtctgagattaactataacccta |
34609351 |
T |
|
| Q |
114 |
tcagcttctccgcgacgagcagctttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609350 |
tcagcttctccgcgacgagcagctttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctc |
34609251 |
T |
|
| Q |
214 |
caggcacaacaacgggaagtggttgctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatg |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609250 |
caggcacaacaacgtgaagtggttgctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatg |
34609151 |
T |
|
| Q |
314 |
atcagcatcaatgctcgttgtttctggtgatcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtctccgttgaa |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34609150 |
atcagcatcaatgctcgttgtttctggtgatcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtcaccgttgaa |
34609051 |
T |
|
| Q |
414 |
gcttcttgt |
422 |
Q |
| |
|
||||||||| |
|
|
| T |
34609050 |
gcttcttgt |
34609042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 32397631 - 32397555
Alignment:
| Q |
138 |
ttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctcc |
214 |
Q |
| |
|
|||||||||||||| || | | ||| |||||||| ||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
32397631 |
ttgtttctcttcttggatgatcccttcgcaagtttgattgctttgatcttttgagcagaatccctaaggccttctcc |
32397555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 138 - 223
Target Start/End: Complemental strand, 6130985 - 6130900
Alignment:
| Q |
138 |
ttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcacaac |
223 |
Q |
| |
|
|||||||||||||| |||| | ||| |||||||| ||||| || |||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
6130985 |
ttgtttctcttcttggaagatcccttcgcaagtttaattgctttgatcttttgagcagaatccctaaggccttctccaggaacaac |
6130900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University