View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_36 (Length: 387)
Name: NF8978_low_36
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 199 - 373
Target Start/End: Complemental strand, 19302228 - 19302054
Alignment:
| Q |
199 |
catgcatggaattctcctctaactacaacaccacaccaacaagagagagatcatagcctatccaataccaccattagcatcaacccttttcttcaaagnn |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19302228 |
catgcatggaattctcctctaactacaacaccacaccaacaagagagagatcatagcctatccaataccaccattagcatcaacccttttcttcaaaaat |
19302129 |
T |
|
| Q |
299 |
nnnnnnnnnnnnnnccattgctaacccattaaattcggttgctttggaaactgaaaattttgaagggttctttct |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19302128 |
tttatttttattttccattgctaacccattaaattcggttgctttggaaactgaaaattttgaagggttctttct |
19302054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 14 - 122
Target Start/End: Complemental strand, 19302413 - 19302305
Alignment:
| Q |
14 |
agacaatttaaggcttagtttggatgtttcagtttttggtttgccaaatttggtactacccttaatcatagggatcttcaaaaacaaatatttaatccta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19302413 |
agacaatttaaggcttagtttggatgtttcagtttttggtttgccaaatttggtactacccttaatcatagggatcttcaaaaacaaatatttaatccta |
19302314 |
T |
|
| Q |
114 |
gtcgtccaa |
122 |
Q |
| |
|
||||||||| |
|
|
| T |
19302313 |
gtcgtccaa |
19302305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University