View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_39 (Length: 375)
Name: NF8978_low_39
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 9814890 - 9814741
Alignment:
| Q |
1 |
cgttgtctaatacatatcaacgtctcatacgacattgacaaatgattacatttaattatgattttttgcaaattattatttatctaaaaatatcagtttt |
100 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| || | ||||||||| |||| |
|
|
| T |
9814890 |
cgttgtttaatacatatcaacgtctgatacgacattgacaaataattacatttaattatgattttttgcaaattattattgatgtcaaaatatcaatttt |
9814791 |
T |
|
| Q |
101 |
agtctttcatagtctaatagaacatagatcaagtccaaaattgtttctat |
150 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9814790 |
agtctttcttagtcaaatagaacatagatcaagtccaaaattgtttctat |
9814741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 9709698 - 9709644
Alignment:
| Q |
232 |
tcaagtgatcaaataacacatttctttata-tttgtg-ttaccactttgttttat |
284 |
Q |
| |
|
|||| |||||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
9709698 |
tcaaatgatcaaatatcacatttctttatattttgtgtttaccactttgttttat |
9709644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University