View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_52 (Length: 290)
Name: NF8978_low_52
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 37 - 273
Target Start/End: Complemental strand, 34340796 - 34340560
Alignment:
| Q |
37 |
agattgatgggttatggtacctaggaaatcattattgttatctggatttcccattctcagtttgccggtgtgatgttacctttttactgatgtattgata |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340796 |
agattgatgggttatggtacctaggaaatcattattgttatctggatttcccattctcagtttgccggtgtgatgttacctttttactgatgtattgata |
34340697 |
T |
|
| Q |
137 |
tgcagctgtatacaattataactactgtgcttggttcacaagccatttactatggatacatctatccccgatcacaatacaagagactgctcaaggtaca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340696 |
tgcagctgtatacaattataactactgtgcttggttcacaagccatttactatggatacatctatccccgatcacaatacaagagactgctcaaggtaca |
34340597 |
T |
|
| Q |
237 |
aattcctatccctatacttatgcttcatatgatcttt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340596 |
aattcctatccctatacttatgcttcatatgatcttt |
34340560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 44
Target Start/End: Original strand, 14241727 - 14241767
Alignment:
| Q |
4 |
acaatgataaaatgctgcttgttctgctgccacagattgat |
44 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
14241727 |
acaatgataaaatgctgctttttctgctgccacatattgat |
14241767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University