View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_62 (Length: 244)
Name: NF8978_low_62
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_62 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 12869995 - 12869752
Alignment:
| Q |
1 |
tttggtttcatggacttgttgggttcccatgattacatnnnnnnnnnnnnnnnnncttttttattatcggattgggtttccaccgtcgccacaacaacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12869995 |
tttggtttcatggacttgttgggttcccatgattacatcaacaacaacaacaacacttttttattatcggattgggttcccaccgtcgccacaacaacaa |
12869896 |
T |
 |
| Q |
101 |
caacccatcacactcttccgtcaccccggagttctaacatcccggactcatcggaggtgtttaacattccggtgtcaccgaattcttcttcgatatcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12869895 |
caacccatcacactcttccgtcacccgggagttctaacatcccggactcatccgaggtgtttaacactccggtgtcaccgaattcttcttcgatatcttc |
12869796 |
T |
 |
| Q |
201 |
gtcgtctaatgaagccacagttaacaacaccttagaacaccata |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12869795 |
gtcgtctaatgaagccacagttaacaacaccttagaacagcata |
12869752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University