View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_70 (Length: 226)
Name: NF8978_low_70
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_70 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 36956253 - 36956462
Alignment:
| Q |
6 |
ttatgggaactgatttaatttttataaggctaatatttatgagtgtaattgggaccatatgnnnnnnnggttggtgtcaaacatgaaatgatactatgag |
105 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36956253 |
ttatgggaattgatttaatttttataaggctaatatttatgagtgtaattgggaccatatgtttttttggttggtgtcaaacatgaaatgatactatgag |
36956352 |
T |
 |
| Q |
106 |
tcaagattacttttcaaactttgatttcattaattatgaagtttcaaatacatgtacggtcggacctttatatgttgtgtttaacaagacaaattattcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956353 |
tcaagattacttttcaaactttgatttcattaattatgaagtttcaaatacatgtacggtcggacctttatatgttgtgtttaacaagacaaattattcc |
36956452 |
T |
 |
| Q |
206 |
actcgagtat |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
36956453 |
actcgagtat |
36956462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University