View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_72 (Length: 217)
Name: NF8978_low_72
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 27859329 - 27859129
Alignment:
| Q |
1 |
tgtggtgatatatgctcttttattttcatctctcttatnnnnnnn-catccaaaattaaaaacataattggattttgaagatagcctgatttagtttgaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27859329 |
tgtggtgatatatgctcttttattttcatctctcttataaaaaaaacatccaaaattaaaaacataattggattttgaagatagcctgatttagtttgaa |
27859230 |
T |
 |
| Q |
100 |
ttgagaactgctagttaagttggattattgaattttggttaaaatttatttgaagtcatttatcttttcgttttaaaagcaaagggaattgcaggaagta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27859229 |
ttgagaactgctagttaagttggattattgaattttggttaaaatttattttaagtcatttatctttttgttttaaaagcaaagggaattgcaggaagta |
27859130 |
T |
 |
| Q |
200 |
t |
200 |
Q |
| |
|
| |
|
|
| T |
27859129 |
t |
27859129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University