View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8978_low_72 (Length: 217)

Name: NF8978_low_72
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8978_low_72
NF8978_low_72
[»] chr8 (1 HSPs)
chr8 (1-200)||(27859129-27859329)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 27859329 - 27859129
Alignment:
1 tgtggtgatatatgctcttttattttcatctctcttatnnnnnnn-catccaaaattaaaaacataattggattttgaagatagcctgatttagtttgaa 99  Q
    ||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27859329 tgtggtgatatatgctcttttattttcatctctcttataaaaaaaacatccaaaattaaaaacataattggattttgaagatagcctgatttagtttgaa 27859230  T
100 ttgagaactgctagttaagttggattattgaattttggttaaaatttatttgaagtcatttatcttttcgttttaaaagcaaagggaattgcaggaagta 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||    
27859229 ttgagaactgctagttaagttggattattgaattttggttaaaatttattttaagtcatttatctttttgttttaaaagcaaagggaattgcaggaagta 27859130  T
200 t 200  Q
    |    
27859129 t 27859129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University