View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_74 (Length: 213)
Name: NF8978_low_74
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_74 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 129 - 195
Target Start/End: Original strand, 12870157 - 12870223
Alignment:
| Q |
129 |
atgatgagttggtggggtttgtgtgcacctctctcttctcctcctccattgatttttatgctgttat |
195 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870157 |
atgatgagttggtggggtttgtgtgctcctctctcttctcctcctccattgatttttatgctgttat |
12870223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 15 - 51
Target Start/End: Original strand, 12870040 - 12870076
Alignment:
| Q |
15 |
agaaggtagagattgaaggttgaaaagggaataaaga |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12870040 |
agaaggtagagattgaaggttgaaaagggaataaaga |
12870076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University