View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_79 (Length: 208)
Name: NF8978_low_79
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 73 - 191
Target Start/End: Complemental strand, 7119605 - 7119487
Alignment:
| Q |
73 |
gttattcattcaatatacttatggtacttgaatattnnnnnnngggaaatggtatatctcgcaagagaatgcttcccgaattatttttattggctaatta |
172 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7119605 |
gttattcattcaacatacttatggtacttgaatattaaaaaaagggaaatggtatatctcgcaagagaatgcttcccgaattatttttattggctaatta |
7119506 |
T |
|
| Q |
173 |
aaccactgacccaccatgt |
191 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7119505 |
aaccactgacccaccatgt |
7119487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 116 - 153
Target Start/End: Complemental strand, 9961832 - 9961795
Alignment:
| Q |
116 |
gggaaatggtatatctcgcaagagaatgcttcccgaat |
153 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9961832 |
gggaaatggtatatctcgtgagagaatgcttcccgaat |
9961795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University