View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8978_low_80 (Length: 207)
Name: NF8978_low_80
Description: NF8978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8978_low_80 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 103 - 142
Target Start/End: Complemental strand, 14172230 - 14172191
Alignment:
| Q |
103 |
tgactgatataatgcatcggatccttttatattgtagaga |
142 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14172230 |
tgaccgatataatgcatcggatccttttatattgcagaga |
14172191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University