View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8979_high_10 (Length: 246)

Name: NF8979_high_10
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8979_high_10
NF8979_high_10
[»] chr5 (1 HSPs)
chr5 (20-179)||(4625363-4625522)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 4625522 - 4625363
Alignment:
20 aggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttgtcgattattgatggtttcaatttgacttctcttgaac 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
4625522 aggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttgtcgattattgatgatttcaatttgacttctcttgaac 4625423  T
120 ttttcccacttcgccggttcatcctcggaatcagatgacctatggtacacttctttgtaa 179  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
4625422 ttttcccacttcgccgattcatcctcggaatcagatgacctatggtacacttctttgtaa 4625363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University