View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8979_low_21 (Length: 246)
Name: NF8979_low_21
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8979_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 20 - 179
Target Start/End: Complemental strand, 4625522 - 4625363
Alignment:
| Q |
20 |
aggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttgtcgattattgatggtttcaatttgacttctcttgaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4625522 |
aggacgaggaggagtttgggaaattcgtgcttcgatggaagcaaatttggaggtggttctttgtcgattattgatgatttcaatttgacttctcttgaac |
4625423 |
T |
 |
| Q |
120 |
ttttcccacttcgccggttcatcctcggaatcagatgacctatggtacacttctttgtaa |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4625422 |
ttttcccacttcgccgattcatcctcggaatcagatgacctatggtacacttctttgtaa |
4625363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University