View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8979_low_23 (Length: 239)
Name: NF8979_low_23
Description: NF8979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8979_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 43996872 - 43996651
Alignment:
| Q |
1 |
cgtggcgaatctgcactagacttgattgat--------tgataaagcagttcgttgaaatcactaagttctaaccggtgacgaaacaaagtggtggtaaa |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43996872 |
cgtggcgaatctgcactagacttgattgattgattgattgataaagcagttcgttgaaatcactaagttctaaccggtgacgaaacaaagtggtggtaaa |
43996773 |
T |
|
| Q |
93 |
ctctattatgaagctgcttgtttgttgaaatcacttatgagtgtgttgatatcgctgccgctgctgttttactctccgatcaaggtgttgttgctaggaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43996772 |
ctctattatgaagctgcttgtttgttgaaatcacttatgagtgtgttgatatcgctgccgctgctgttttactctccgatcaaggtgatgttgctaggaa |
43996673 |
T |
|
| Q |
193 |
tacaatgttaggttccaactgc |
214 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
43996672 |
tacaatgttaggttccaactgc |
43996651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 32068315 - 32068366
Alignment:
| Q |
76 |
aacaaagtggtggtaaactctattatgaagctgcttgtttgttgaaatcacttat |
130 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
32068315 |
aacaaagtggtggtaaactatat---gaagctgcttgtttgttgaaatcacttat |
32068366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 32068463 - 32068495
Alignment:
| Q |
178 |
tgttgttgctaggaatacaatgttaggttccaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32068463 |
tgttgttgctaggaatacaatgttaggttccaa |
32068495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University